Dinucleotide repeat polymorphism at the SIS locus

Patterson, H., Mitchell, P. J., Cooper, C. S. and Stratton, M. R. (1990) Dinucleotide repeat polymorphism at the SIS locus. Nucleic Acids Research, 18 (19). p. 5917. ISSN 0305-1048

Full text not available from this repository. (Request a copy)
Item Type: Article
Additional Information: Funding Information: Dinucleotide repeat sequences of the form (G-T)n are highly polymorphic and represent an important new pool of genetic markers. Using the polymerase chain reaction and primers flanking the (G-T)n region, one of which is end-labelled with y^P dATP, these polymorphic alleles can be amplified and distinguished by electrophoresis in polyacrylamide gels. Primer Sequences: AGAGGTGAATTTGCAAGTGA (GT strand); AGTGATGGTTATTACTGCAG (CA strand). PCR Conditions: PCR was carried out in a total volume of 100 /J containing 1 fig genomic DNA; 25 pmols of each primer with an additional 0.2 pmol of radiolabelled CA strand primer; 400 fM of each dNTP's; 50 mM KC1, 10 mM Tris-HCl pH 8.3, 1.5 mM MgCl2, 0.01% w/v gelatin; 2 units Taq polymerase (Cetus). Each amplification was performed for 30 cycles, 1 minute at 93°C, 1 minute at 57°C and 1 minute at 72°C. Polymorphism: PCR detects five alleles. Sequencing of two subcloned alleles revealed that the variation in size results from changes in the length of the (G-T)n region and of an adjacent (G-C)nregion. Allele Al (G-T)l2 (G-C)4 (G-A^Allele A4 (G-T)17 (G-C)4C (G-A)2 Chromosomal Localization: 4.7 kb upstream of the 'TATA' box of the c-sis proto-oncogene on chromosome 22 (1). Frequency: Allele frequencies were calculated from 28 unrelated individuals. Mendelian Inheritance: Codominant segregation was shown in 1 informative two generation family (14 individuals). AlWc Allele (bp) Frequency Al 85 064 A2 87 007 A3 89 004 A4 96 030 A3 98 003 He»crozygo*lly in our simple - 57%. Acknowledgements: We thank Bruce Ponder for DNA samples. This work was supported by grants from the Cancer Research Campaign and the Medical Research Council. References: 1) Van den Ouweland.A.M.W., van Groningen.J.J.M., Hendricksen.P.J.M., Bloemers.H.P.J. and Van de Ven,W.J.M. (1987) Nucl. Acids Res. 15,4349. 2) Litt.M. and Luty,J.A. (1989) Am. J. Hum. Genet. 44, 397-401. Funding Information: Acknowledgements: We thank R.Cortese for providing a prothrombin partial cDNA clone. Supported in part by Sanofi B.V.
Uncontrolled Keywords: genetics ,/dk/atira/pure/subjectarea/asjc/1300/1311
Faculty \ School: Faculty of Medicine and Health Sciences > Norwich Medical School
UEA Research Groups: Faculty of Medicine and Health Sciences > Research Groups > Cancer Studies
Related URLs:
Depositing User: LivePure Connector
Date Deposited: 18 Jul 2022 17:31
Last Modified: 28 Mar 2025 11:32
URI: https://ueaeprints.uea.ac.uk/id/eprint/86550
DOI: 10.1093/nar/18.19.5917-a

Actions (login required)

View Item View Item